UGCAUAACAGCUACGAGGAAAU
| Count | Sample ID | Experiment title |
|---|---|---|
| 9 | GSM605661 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 3 | GSM253625 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 3 | GSM605658 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 3 | GSM605659 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 2 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM387514 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 1 | GSM415797 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 1 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 1 | GSM605662 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 1 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |