AUCAGAUAUUUCACGAAGAUAUC
| Count | Sample ID | Experiment title |
|---|---|---|
| 35 | GSM253624 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 25 | GSM707686 | Characterization of AGO1-/AGO4-associated smRNAs |
| 6 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM456944 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
| 1 | GSM506666 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 1 | GSM605665 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 1 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |