AUCAGAUAUUUCACGAAGAUAU
| Count | Sample ID | Experiment title |
|---|---|---|
| 4 | GSM253625 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 4 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM253624 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM253623 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM284749 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM415796 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 1 | GSM605663 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 1 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |