UCCUUGUGGCAGAGUUAUGACUUU
| Count | Sample ID | Experiment title |
|---|---|---|
| 1 | GSM284749 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM518443 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |