UGGGCGAAUACUCCUAUGGCAGA
| Count | Sample ID | Experiment title |
|---|---|---|
| 17 | GSM711892 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 6 | GSM711893 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 3 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |