UGGGCGAAUACUCCUAUGGCA
| Count | Sample ID | Experiment title |
|---|---|---|
| 8 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 3 | GSM711892 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 2 | GSM442934 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 2 | GSM711893 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |