Sequence

UUAUAUGUUCUUCUCUCUCAUC

Expression details
CountSample IDExperiment title
6GSM707679Characterization of AGO1-/AGO4-associated smRNAs
3GSM707683Characterization of AGO1-/AGO4-associated smRNAs
2GSM707685Characterization of AGO1-/AGO4-associated smRNAs
2GSM707689Characterization of AGO1-/AGO4-associated smRNAs
1GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506680Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs
1GSM707687Characterization of AGO1-/AGO4-associated smRNAs
1GSM707691Characterization of AGO1-/AGO4-associated smRNAs