UAGCCAAGGAUGACUUGCCUGUU
| Count | Sample ID | Experiment title |
|---|---|---|
| 19 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 13 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 8 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 7 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 7 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM118374 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 1 | GSM121454 | Small RNA identification in Arabidopsis thaliana using 454 data |
| 1 | GSM121455 | Small RNA identification in Arabidopsis thaliana using 454 data |
| 1 | GSM304285 | ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing |
| 1 | GSM366867 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 1 | GSM415798 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM456944 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
| 1 | GSM456945 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
| 1 | GSM491576 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM506683 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM512703 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
| 1 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 1 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 1 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |