GUAGCCAAGGAUGACUUGCCUG
Count | Sample ID | Experiment title |
---|---|---|
6 | GSM154377 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
3 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
3 | GSM491576 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
2 | GSM253622 | Small RNAs in four Argonaute complexes in Arabidopsis |
2 | GSM491572 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
2 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
2 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
2 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM253623 | Small RNAs in four Argonaute complexes in Arabidopsis |
1 | GSM424847 | Low oxygen responsive small RNAs in Arabidopsis |
1 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
1 | GSM456945 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
1 | GSM491570 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM491574 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM491577 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
1 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |