GUAGCCAAGGAUGACUUGCCU
Count | Sample ID | Experiment title |
---|---|---|
3 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM424848 | Low oxygen responsive small RNAs in Arabidopsis |
1 | GSM491569 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM491571 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM506684 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
1 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |