GGUAGCCAAGGAUGACUUGCC
Count | Sample ID | Experiment title |
---|---|---|
7 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
5 | GSM118374 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
3 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
2 | GSM366867 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
2 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
2 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
1 | GSM415786 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM415798 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
1 | GSM491576 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
1 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |