Sequence

AUCGAUAAACCUCUGCAUCC

Expression details
CountSample IDExperiment title
3GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707678Characterization of AGO1-/AGO4-associated smRNAs
2GSM707679Characterization of AGO1-/AGO4-associated smRNAs
2GSM707680Characterization of AGO1-/AGO4-associated smRNAs
2GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs