UAUGUCUUGUUGAUCUCAAUAGCA
| Count | Sample ID | Experiment title |
|---|---|---|
| 27 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707687 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM491574 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 2 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM491577 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |