Sequence

AAUAGAUUGGACUAUGUAUA

Expression details
CountSample IDExperiment title
2GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284750A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs