AAACGAACAAAAAACUGAUGGAA
| Count | Sample ID | Experiment title |
|---|---|---|
| 2 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 2 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM605659 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 1 | GSM707688 | Characterization of AGO1-/AGO4-associated smRNAs |