AAACAUGAGGACUUUAUACUUGUA
| Count | Sample ID | Experiment title |
|---|---|---|
| 2 | GSM707688 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM415786 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM442934 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707686 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM711894 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |