Sequence

UUACUUCUGAUCUCUUCGUAC

Expression details
CountSample IDExperiment title
18GSM707682Characterization of AGO1-/AGO4-associated smRNAs
10GSM707691Characterization of AGO1-/AGO4-associated smRNAs
5GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
5GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
4GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
4GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
4GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
4GSM707690Characterization of AGO1-/AGO4-associated smRNAs
3GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM554062Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
2GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM121457Small RNA identification in Arabidopsis thaliana using 454 data
1GSM149080Small RNAs in Arabidopsis thaliana and its RISC complexes
1GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284749A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284750A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM415783Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415784Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415791Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415792Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM554064Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs