Sequence

UGAUCUCUUCGUACUCUUCU

Expression details
CountSample IDExperiment title
2GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0