Sequence

UACUUCUGAUCUCUUCGUACU

Expression details
CountSample IDExperiment title
8GSM707690Characterization of AGO1-/AGO4-associated smRNAs
6GSM707682Characterization of AGO1-/AGO4-associated smRNAs
2GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM707691Characterization of AGO1-/AGO4-associated smRNAs
1GSM149080Small RNAs in Arabidopsis thaliana and its RISC complexes
1GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM415791Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs