CUUGUUUGGUGUGUUUACUUC
| Count | Sample ID | Experiment title |
|---|---|---|
| 2 | GSM253625 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM506684 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506686 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM554064 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 1 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |