Sequence

AGAAGCGUACAAGGAGAUGAGGAG

Expression details
CountSample IDExperiment title
2GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM415791Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415792Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis