UCAUCAUCAUCAUCAUCAUC
| Count | Sample ID | Experiment title |
|---|---|---|
| 90 | GSM707687 | Characterization of AGO1-/AGO4-associated smRNAs |
| 67 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
| 49 | GSM707688 | Characterization of AGO1-/AGO4-associated smRNAs |
| 26 | GSM707686 | Characterization of AGO1-/AGO4-associated smRNAs |
| 21 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 20 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 18 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 15 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 14 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 12 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 11 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 10 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM253625 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM512702 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
| 1 | GSM512703 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
| 1 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |