Sequence

UGCCAAAGGAGAUUUGCCCGGU

Expression details
CountSample IDExperiment title
132GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
126GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
117GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
19GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
14GSM707681Characterization of AGO1-/AGO4-associated smRNAs
12GSM707690Characterization of AGO1-/AGO4-associated smRNAs
11GSM707682Characterization of AGO1-/AGO4-associated smRNAs
11GSM707685Characterization of AGO1-/AGO4-associated smRNAs
6GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
5GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
4GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
2GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM118375High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
1GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM506674Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM554065Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs
1GSM707686Characterization of AGO1-/AGO4-associated smRNAs