Sequence

UCUGCCAAAGGAGAUUUGCCCGG

Expression details
CountSample IDExperiment title
22GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
19GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
4GSM707685Characterization of AGO1-/AGO4-associated smRNAs
3GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
3GSM707682Characterization of AGO1-/AGO4-associated smRNAs
3GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
2GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs