Sequence

GGGCAAGAUCACCAUUGGCAGAGA

Expression details
CountSample IDExperiment title
157GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
27GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
24GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
4GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM424847Low oxygen responsive small RNAs in Arabidopsis