Sequence

GCCAAAGGAGAUUUGCCCGG

Expression details
CountSample IDExperiment title
7GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
6GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
4GSM707690Characterization of AGO1-/AGO4-associated smRNAs
2GSM707681Characterization of AGO1-/AGO4-associated smRNAs
2GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
1GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs