Sequence

CUGCCAAAGGAGAUUUGCCCGG

Expression details
CountSample IDExperiment title
90GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
57GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
18GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
9GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
5GSM253625Small RNAs in four Argonaute complexes in Arabidopsis
4GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM707681Characterization of AGO1-/AGO4-associated smRNAs
2GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
2GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM121454Small RNA identification in Arabidopsis thaliana using 454 data
1GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM424847Low oxygen responsive small RNAs in Arabidopsis
1GSM424848Low oxygen responsive small RNAs in Arabidopsis
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana