Sequence

UGCCAAAGGAGAGUUGCCCUGU

Expression details
CountSample IDExperiment title
74GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
46GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
37GSM707682Characterization of AGO1-/AGO4-associated smRNAs
26GSM707690Characterization of AGO1-/AGO4-associated smRNAs
14GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
13GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
13GSM707691Characterization of AGO1-/AGO4-associated smRNAs
12GSM707685Characterization of AGO1-/AGO4-associated smRNAs
8GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
8GSM707681Characterization of AGO1-/AGO4-associated smRNAs
6GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
3GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM707678Characterization of AGO1-/AGO4-associated smRNAs
3GSM707683Characterization of AGO1-/AGO4-associated smRNAs
3GSM707684Characterization of AGO1-/AGO4-associated smRNAs
2GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506682Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM149079Small RNAs in Arabidopsis thaliana and its RISC complexes
1GSM257237High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM415785Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM424743smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491569Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506677Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs