Sequence

GGGCAUCUUUCUAUUGGCAGGCGA

Expression details
CountSample IDExperiment title
8GSM707689Characterization of AGO1-/AGO4-associated smRNAs
5GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
1GSM424847Low oxygen responsive small RNAs in Arabidopsis
1GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707688Characterization of AGO1-/AGO4-associated smRNAs
1GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings