GGGCAUCUUUCUAUUGGCAGGCGA
| Count | Sample ID | Experiment title |
|---|---|---|
| 8 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
| 5 | GSM253624 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM424847 | Low oxygen responsive small RNAs in Arabidopsis |
| 1 | GSM605665 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 1 | GSM707688 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM711892 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |