Sequence

AGGGCAUCUUUCUAUUGGCAGG

Expression details
CountSample IDExperiment title
8GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
3GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
2GSM424847Low oxygen responsive small RNAs in Arabidopsis
2GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM518391MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM154364Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing