AGGGCAUCUUUCUAUUGGCAGG
| Count | Sample ID | Experiment title |
|---|---|---|
| 8 | GSM711892 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 3 | GSM711893 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 2 | GSM424847 | Low oxygen responsive small RNAs in Arabidopsis |
| 2 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 2 | GSM506664 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM518391 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 1 | GSM154364 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 1 | GSM442934 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |