Sequence

ACUUGCCAAAGGAGAGUUGCCCUG

Expression details
CountSample IDExperiment title
17GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
9GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
9GSM707689Characterization of AGO1-/AGO4-associated smRNAs
1GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
1GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing