Sequence

UGCCAAAGGAGAUUUGCCCU

Expression details
CountSample IDExperiment title
7GSM707690Characterization of AGO1-/AGO4-associated smRNAs
5GSM707682Characterization of AGO1-/AGO4-associated smRNAs
4GSM707685Characterization of AGO1-/AGO4-associated smRNAs
2GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
2GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
1GSM253625Small RNAs in four Argonaute complexes in Arabidopsis
1GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi