Sequence

UCUGCCAAAGGAGAUUUGCCCUG

Expression details
CountSample IDExperiment title
9GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
3GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
3GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
3GSM707681Characterization of AGO1-/AGO4-associated smRNAs
3GSM707682Characterization of AGO1-/AGO4-associated smRNAs
3GSM707685Characterization of AGO1-/AGO4-associated smRNAs
3GSM707690Characterization of AGO1-/AGO4-associated smRNAs
1GSM253625Small RNAs in four Argonaute complexes in Arabidopsis
1GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM707683Characterization of AGO1-/AGO4-associated smRNAs
1GSM707689Characterization of AGO1-/AGO4-associated smRNAs
1GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
1GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings