Sequence

UUGUGUUCUCAGGUCACCCCU

Expression details
CountSample IDExperiment title
689GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
6GSM253623Small RNAs in four Argonaute complexes in Arabidopsis
4GSM707683Characterization of AGO1-/AGO4-associated smRNAs
2GSM506672Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506678Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM118373High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506662Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs