GUGUUCUCAGGUCACCCCUU
| Count | Sample ID | Experiment title |
|---|---|---|
| 131 | GSM253622 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM387519 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 1 | GSM491576 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |