Sequence

GGAGUGGCAUGUGAACACAU

Expression details
CountSample IDExperiment title
19GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
6GSM711891Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
6GSM711894Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
4GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
4GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM506662Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM304282ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
1GSM415783Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491569Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518441small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518444small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0