Sequence

GAGUGGCAUGUGAACACAUAU

Expression details
CountSample IDExperiment title
2GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings