Sequence

AGGAGUGGCAUGUGAACACA

Expression details
CountSample IDExperiment title
50GSM253623Small RNAs in four Argonaute complexes in Arabidopsis
6GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
2GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415789Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518444small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518450small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518457small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518466small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707679Characterization of AGO1-/AGO4-associated smRNAs