Sequence

UUGAGUGCAGCGUUGAUGUAA

Expression details
CountSample IDExperiment title
2GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
1GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana