Sequence

UCAUUGAGUGCAGCGUUGAUGUA

Expression details
CountSample IDExperiment title
14GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
9GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
6GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
6GSM506662Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
6GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM154336Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
4GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
4GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM154368Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
2GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506676Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM554064Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM154362Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM154364Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM154372Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518466small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs