Sequence

AAGAAUUUAUACCAGCGUUGCGCU

Expression details
CountSample IDExperiment title
4GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM707687Characterization of AGO1-/AGO4-associated smRNAs