Sequence

CUGAAGUGUUUGGGGGGACUCU

Expression details
CountSample IDExperiment title
14GSM707691Characterization of AGO1-/AGO4-associated smRNAs
7GSM707683Characterization of AGO1-/AGO4-associated smRNAs
4GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM707679Characterization of AGO1-/AGO4-associated smRNAs
4GSM707684Characterization of AGO1-/AGO4-associated smRNAs
2GSM707680Characterization of AGO1-/AGO4-associated smRNAs
2GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM415796Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs