CUGAAGUGUUUGGGGGAACUCC
| Count | Sample ID | Experiment title |
|---|---|---|
| 11 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM343005 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 3 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM343001 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 2 | GSM343002 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 2 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM149080 | Small RNAs in Arabidopsis thaliana and its RISC complexes |
| 1 | GSM366870 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing |
| 1 | GSM506681 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |