Sequence

UUUGGACUGAAGGGAGCUCCUUC

Expression details
CountSample IDExperiment title
12GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
7GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
4GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
4GSM707682Characterization of AGO1-/AGO4-associated smRNAs
3GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM554063Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
2GSM707685Characterization of AGO1-/AGO4-associated smRNAs
2GSM707690Characterization of AGO1-/AGO4-associated smRNAs
1GSM257237High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM424742smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506671Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506680Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518450small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM554065Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs
1GSM707691Characterization of AGO1-/AGO4-associated smRNAs