UUUGGACUGAAGGGAGCUCCUUC
| Count | Sample ID | Experiment title |
|---|---|---|
| 12 | GSM343004 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 7 | GSM343001 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 4 | GSM343002 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 4 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM342999 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 3 | GSM343005 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 3 | GSM506663 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM506657 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM506667 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM554063 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 2 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM257237 | High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants |
| 1 | GSM343000 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 1 | GSM424742 | smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf |
| 1 | GSM506659 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506660 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506665 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506666 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506671 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506680 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506684 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506687 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506689 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506690 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506691 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM518432 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 1 | GSM518450 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM554065 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 1 | GSM605661 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 1 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |