Sequence

UUUGGACUGAAGGGAGCUCCUU

Expression details
CountSample IDExperiment title
156GSM554065Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
107GSM707690Characterization of AGO1-/AGO4-associated smRNAs
104GSM707682Characterization of AGO1-/AGO4-associated smRNAs
102GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
84GSM707691Characterization of AGO1-/AGO4-associated smRNAs
83GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
78GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
76GSM707685Characterization of AGO1-/AGO4-associated smRNAs
55GSM707683Characterization of AGO1-/AGO4-associated smRNAs
45GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
43GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
42GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
40GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
34GSM707684Characterization of AGO1-/AGO4-associated smRNAs
31GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
30GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
25GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
24GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
24GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
24GSM707678Characterization of AGO1-/AGO4-associated smRNAs
23GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
21GSM707681Characterization of AGO1-/AGO4-associated smRNAs
18GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
18GSM554062Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
17GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
14GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
14GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
13GSM506680Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
13GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
12GSM506662Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
10GSM366865Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
10GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
10GSM554064Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
9GSM304283ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
9GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
9GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
9GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
8GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
8GSM424743smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
7GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
7GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
7GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
7GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
7GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
7GSM554063Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
7GSM707680Characterization of AGO1-/AGO4-associated smRNAs
6GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
5GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
5GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
5GSM506682Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM304282ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
4GSM304285ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
4GSM424742smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
3GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
2GSM154367Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
2GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
2GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2GSM707688Characterization of AGO1-/AGO4-associated smRNAs
1GSM121454Small RNA identification in Arabidopsis thaliana using 454 data
1GSM149079Small RNAs in Arabidopsis thaliana and its RISC complexes
1GSM154336Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM154376Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
1GSM257237High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM304284ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
1GSM424744smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM506674Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518430MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518439small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518440small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518441small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518444small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518449small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518450small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518451small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518453small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518455small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518456small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518457small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518458small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518459small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518464small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518466small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518467small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM707686Characterization of AGO1-/AGO4-associated smRNAs
1GSM707687Characterization of AGO1-/AGO4-associated smRNAs
1GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
1GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings