Sequence

UUUGGACUGAAGGGAGCUCC

Expression details
CountSample IDExperiment title
95GSM707685Characterization of AGO1-/AGO4-associated smRNAs
80GSM707682Characterization of AGO1-/AGO4-associated smRNAs
40GSM707691Characterization of AGO1-/AGO4-associated smRNAs
37GSM707690Characterization of AGO1-/AGO4-associated smRNAs
27GSM707678Characterization of AGO1-/AGO4-associated smRNAs
22GSM707683Characterization of AGO1-/AGO4-associated smRNAs
17GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
17GSM707684Characterization of AGO1-/AGO4-associated smRNAs
16GSM707679Characterization of AGO1-/AGO4-associated smRNAs
10GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
9GSM707680Characterization of AGO1-/AGO4-associated smRNAs
8GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
7GSM707681Characterization of AGO1-/AGO4-associated smRNAs
5GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
5GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM424744smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
2GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506680Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM554065Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM424743smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506662Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518450small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518453small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518457small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518458small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518461small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518466small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707686Characterization of AGO1-/AGO4-associated smRNAs
1GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings