Sequence

UUGGACUGAAGGGAGCUCCUUC

Expression details
CountSample IDExperiment title
201GSM707682Characterization of AGO1-/AGO4-associated smRNAs
127GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
121GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
108GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
99GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
97GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
96GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
87GSM707685Characterization of AGO1-/AGO4-associated smRNAs
86GSM707683Characterization of AGO1-/AGO4-associated smRNAs
83GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
72GSM707691Characterization of AGO1-/AGO4-associated smRNAs
69GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
61GSM554065Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
60GSM707684Characterization of AGO1-/AGO4-associated smRNAs
54GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
51GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
51GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
50GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
46GSM506680Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
42GSM506682Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
41GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
40GSM707690Characterization of AGO1-/AGO4-associated smRNAs
38GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
36GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
31GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
31GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
30GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
29GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
29GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
28GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
27GSM506662Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
26GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
18GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
18GSM707681Characterization of AGO1-/AGO4-associated smRNAs
17GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
17GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
16GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
15GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
15GSM707678Characterization of AGO1-/AGO4-associated smRNAs
10GSM304282ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
9GSM707679Characterization of AGO1-/AGO4-associated smRNAs
8GSM554063Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
7GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
7GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
7GSM707680Characterization of AGO1-/AGO4-associated smRNAs
6GSM554062Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
6GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
5GSM304283ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
5GSM605660Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
4GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
3GSM257237High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
3GSM366865Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
3GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
3GSM554064Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
3GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
2GSM257236High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
2GSM304284ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
2GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM154336Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
1GSM253625Small RNAs in four Argonaute complexes in Arabidopsis
1GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM506676Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518430MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518439small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518440small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518450small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518451small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518453small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518456small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518458small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518461small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518464small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518465small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518466small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707686Characterization of AGO1-/AGO4-associated smRNAs
1GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
1GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings