Sequence

UGUGAAUGAUGCGGGAGAUA

Expression details
CountSample IDExperiment title
5GSM605660Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
4GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
4GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
3GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
3GSM711891Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
2GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506677Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2GSM707682Characterization of AGO1-/AGO4-associated smRNAs
2GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM415783Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415784Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415791Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415792Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415796Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415797Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM424847Low oxygen responsive small RNAs in Arabidopsis
1GSM424848Low oxygen responsive small RNAs in Arabidopsis
1GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518444small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518449small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518455small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518457small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518458small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518459small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518466small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707686Characterization of AGO1-/AGO4-associated smRNAs
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs
1GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
1GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings