Sequence

GGAGAUUCUUUCAGUCCAGUC

Expression details
CountSample IDExperiment title
9GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
5GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
5GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
4GSM118373High-throughput sequencing of small RNAs from Arabidopsis thaliana
4GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM118375High-throughput sequencing of small RNAs from Arabidopsis thaliana
2GSM257235High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
2GSM506662Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707678Characterization of AGO1-/AGO4-associated smRNAs
2GSM707679Characterization of AGO1-/AGO4-associated smRNAs
2GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM149079Small RNAs in Arabidopsis thaliana and its RISC complexes
1GSM257236High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM257237High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs