Sequence

GAGAUUCUUUCAGUCCAGUC

Expression details
CountSample IDExperiment title
22GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
9GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
6GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
4GSM707681Characterization of AGO1-/AGO4-associated smRNAs
3GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM257236High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
2GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM304282ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
1GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM415796Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506678Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506680Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518431MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518457small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM554062Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs